Wörterbuch Deutsch Cookies werden verwendet, um Anzeigen zu personalisieren und zu Web-Traffic-Statistiken. Außerdem geben wir Informationen zu Ihrer Nutzung unserer Website an unsere Partner für soziale Medien, Werbung und Analysen weiter. Details anzeigen
akzeptieren
to top

Bedeutung von g. g. T. im Wörterbuch Deutsch

Wörterbuch
WÖRTERBUCH
section

AUSSPRACHE VON G. G. T. AUF DEUTSCH

g. g. T. play
section

WAS BEDEUTET G. G. T. AUF DEUTSCH

definitiondefinition von g. g. T. im Wörterbuch Deutsch

größter gemeinsamer Teiler.
section

WÖRTER, DIE ANFANGEN WIE G. G. T.

g. g. T.
info
Diese Wörter im Wörterbuch haben die gleiche Wurzel wie g. g. T.. Klicke auf die Wörter, um mehr Informationen zu laden.

Synonyme und Antonyme von g. g. T. auf Deutsch im Synonymwörterbuch

Synonyme
SYNONYME
section

MIT «G. G. T.» VERWANDTE WÖRTER

g. g. T.  g  T Grammatik Wörterbuch wörterbuch Duden bedeutung Grammatik nachschlagen deutschen Sprache Chromosome broad institute Experimental demonstration hexad Biochemistry tetrad alignments within quadruplex stem Isolated named strains aligned Fasta greengenes AACA ATTA GATG x∗ t∗ tefillos Logbot developers https mozilla integration inbound Mike Ho mmey Keep flags from MOZ_GTK _LIBS when building Language What result exact double strands Codons found messenger Protein Synthesis Poly hydroxybutyrate depolymerase CSDVDTASVG TYACTYSATD SDTNETTVTR SVEVYDPKAP VETCQQATAS PS GHISAGRA YAGGTSNLRA YANGDDADIG ASFDSWSSVV LYEGEPGQWF nexus subset data begin dimensions ntax= NEXUS Subset BEGIN DATA DIMENSIONS NTAX= NCHAR= FORMAT INTERLEAVE MISSING= GAP= MATCHCHAR= DATATYPE=DNA ratio answers Read answer complimentary mRNA strand Piggis→Cluster→Bgisusx BGISUSX TGTTACGTTGGTGCTGCTACTGTGGGTGCTGCTGCGT GGTGGTTCATTGCTGCCGATGGTGGTCCAAGAGTGACCTTCTACCAGCTG größter gemeinsamer

Übersetzung von g. g. T. auf 20 Sprachen

Übersetzer
ÜBERSETZER
online translator
translator

ÜBERSETZUNG VON G. G. T.

Erfahre, wie die Übersetzung von g. g. T. auf 20 Sprachen mit unserem mehrsprachigen Übersetzer Deutsch lautet.
info
Die Übersetzungen von g. g. T. auf andere Sprachen, die in diesem Bereich vorgestellt werden, sind zustande gekommen durch automatische statistische Übersetzung, wobei die Basiseinheit der Übersetzung das Wort «g. g. T.» in Deutsch ist.
Chinesisch Spanisch Englisch Hindi Arabisch Russisch Portugiesisch Französisch Deutsch Japanisch Koreanisch Vietnamesisch Italienisch Polnisch Ukrainisch Rumänisch Griechisch Afrikaans Schwedisch Norwegisch
maps
Sprachen  
zh

Übersetzer Deutsch - Chinesisch

G G T。
1.325 Millionen Sprecher
map
map
es

Übersetzer Deutsch - Spanisch

g g T.
550 Millionen Sprecher
map
map
en

Übersetzer Deutsch - Englisch

g g T.
510 Millionen Sprecher
map
map
hi

Übersetzer Deutsch - Hindi

जी जी टी.
380 Millionen Sprecher
map
map
ar

Übersetzer Deutsch - Arabisch

ز ز ت.
280 Millionen Sprecher
map
map
ru

Übersetzer Deutsch - Russisch

г г Т.
278 Millionen Sprecher
map
map
pt

Übersetzer Deutsch - Portugiesisch

g g T.
270 Millionen Sprecher
map
map
fr

Übersetzer Deutsch - Französisch

g g T.
220 Millionen Sprecher
map
map
de

Übersetzer Deutsch - Deutsch

g. g. T.
180 Millionen Sprecher
map
map
ja

Übersetzer Deutsch - Japanisch

G G T.
130 Millionen Sprecher
map
map
ko

Übersetzer Deutsch - Koreanisch

G G T.
85 Millionen Sprecher
map
map
vi

Übersetzer Deutsch - Vietnamesisch

g g T.
80 Millionen Sprecher
map
map
it

Übersetzer Deutsch - Italienisch

g g T.
65 Millionen Sprecher
map
map
pl

Übersetzer Deutsch - Polnisch

g g T.
50 Millionen Sprecher
map
map
uk

Übersetzer Deutsch - Ukrainisch

г г Т.
40 Millionen Sprecher
map
map
ro

Übersetzer Deutsch - Rumänisch

g g T.
30 Millionen Sprecher
map
map
el

Übersetzer Deutsch - Griechisch

g g T.
15 Millionen Sprecher
map
map
af

Übersetzer Deutsch - Afrikaans

g g T.
14 Millionen Sprecher
map
map
sv

Übersetzer Deutsch - Schwedisch

g g T.
10 Millionen Sprecher
map
map
no

Übersetzer Deutsch - Norwegisch

g g T.
5 Millionen Sprecher
map
map

Tendenzen beim Gebrauch von g. g. T.

Tendenzen
TENDENZEN
section

TENDENZEN BEIM GEBRAUCH DES BEGRIFFES «G. G. T.»

Der Begriff «g. g. T.» wird sehr häufig gebraucht und belegt den Platz 2.897 auf unserer Liste der meistgebrauchten Begriffe des Wörterbuch auf Deutsch.
0
100
HÄUFIGKEIT
Sehr häufig gebraucht
97
/100
stars
info
Auf der vorherigen Grafik wird die Häufigkeit der Nutzung des Begriffs «g. g. T.» in den verschiedenen Ländern angezeigt.
Wichtigste Tendenzen bei der Suche und dem allgemeinen Gebrauch von g. g. T.
info
Liste der wichtigsten Suchen, die von den Nutzern bei dem Zugang zu unserem Wörterbuch Deutsch durchgeführt wurden und die meistgebrauchten Ausdrücke mit dem Wort «g. g. T.».

Zitate, Bibliographie und Aktuelles übe g. g. T. auf Deutsch

Beispiele
BEISPIELE
section

10 BÜCHER, DIE MIT «G. G. T.» IM ZUSAMMENHANG STEHEN

Entdecke den Gebrauch von g. g. T. in der folgenden bibliographischen Auswahl. Bücher, die mit g. g. T. im Zusammenhang stehen und kurze Auszüge derselben, um seinen Gebrauch in der Literatur kontextbezogen darzustellen.
1
C.G.J. Jacobi mathematische Werke
... g G t G G G 9 G t G t t q G t 9 G G t i t t t G t 9 e G i q t g f: G G g t t t t G G t g g t £ G f e 9 G q i <_□ t q t '.) e 5 C OS (il- SP LI <JT' KY II CI 6 1 II Diet: st; L£ 9£ S8 IC EC se It: (it: Co 86 Z6 9S l-T- I 6 BZ 66 16 02 61 81 ZT 91 <:i ii ei 6l II 01 6 8 L 9 ...
autorCarl Gustav Jakob Jacobi, 1846
Teile C.G.J. Jacobi mathematische Werke auf Facebook Teile C.G.J. Jacobi mathematische Werke auf Google + Teile C.G.J. Jacobi mathematische Werke auf Twitter
2
Journal für die reine und angewandte Mathematik
Hae formulae inter alia docent, pro quantitatibus G, — G', — G", — G"'t ne e quantitatibus«, ß etc. quaedam in infmitum abeant, diversas statui debere aequationis (VI.) radices. Ceterum analysin, cuiua ope aequa- tiones (X. et XI.) inventae ...
autorAugust Leopold Crelle, Carl Wilhelm Borchardt, Leopold Kronecker, 1827
Teile Journal für die reine und angewandte Mathematik auf Facebook Teile Journal für die reine und angewandte Mathematik auf Google + Teile Journal für die reine und angewandte Mathematik auf Twitter
3
Gespräche über die Überschwemmungen im Seelande der ...
F g . _. . g - g - - - x g - . - F _ - g - g ( . . _ 1 g - F- g - . _ . g » . . - _ . 1 g_ | _ g _ .1 XX -- . - - g . - - g . . » _-- . - _ . - . . - -- g g x g . _ - g -| g . _ _ -4 . - g . . - . g . . - - .- _ . - _ t - 4 g . g - - _ - g - g-. -» - - . . F - _ »- . . - - g . . - g - - - - - T- *Ä g . -. -1- - - g - g .
autorC ..... Schneider, 1835
Teile Gespräche über die Überschwemmungen im Seelande der ... auf Facebook Teile Gespräche über die Überschwemmungen im Seelande der ... auf Google + Teile Gespräche über die Überschwemmungen im Seelande der ... auf Twitter
4
Evolutionsbiologie
Brevibacierium aibidum """T"G"G"C"C"A———— —-——'I'—G—G C—A—A—— —— ——-—A—C—C—G—G—T—-—— -———A—C—C G—T—T——-Sau3A Staphyiococcus aureus """G'A'T'C'u'" '"' G'A'T'C“" ...
autorVolker Storch, Ulrich Welsch, Michael Wink, 2013
Teile Evolutionsbiologie auf Facebook Teile Evolutionsbiologie auf Google + Teile Evolutionsbiologie auf Twitter
5
Codierungstheorie
Dann sind äquivalent: a) G ist eine Diedergruppe. b) G = (g, t), wobei (g) ein zyklischer Normalteiler vom Index 2 und t eine Involution mit g' = g" ist. Beweis. Sei G eine Diedergruppe, also G = (t, s) mit Involutionen t, s. Setzen wir g = st, so gilt g' ...
autorWolfgang Willems, 2012
Teile Codierungstheorie auf Facebook Teile Codierungstheorie auf Google + Teile Codierungstheorie auf Twitter
6
In Other Words: Transcultural Studies in Philology, ...
_r- -E; J^ J^ fH f1^ H G- G- "- G: G= -t K g* a *^ Ei* •0 x- •M S PH S ^ cJ « S h 0 ,£3 m • OS J3 M co co (M (M T-l CC (M ca T-l s n 53 0? M) W • PM C f t- G^ G^ G" S5> - r h G- G" The working vocabulary of a farm in Northeast Scotland in the mid- ...
autorJ. Lachlan Mackenzie, Richard Todd, 1989
Teile In Other Words: Transcultural Studies in Philology, ... auf Facebook Teile In Other Words: Transcultural Studies in Philology, ... auf Google + Teile In Other Words: Transcultural Studies in Philology, ... auf Twitter
7
Aargauer W?rterbuch
g't'aro, Gefahr laufen: es ist niit e'g'iora. g'irtia (_1), das, vergrößernd fiir g'a'ieht: ea ninelit ee g. 'ri (li-irebe bagreger-feder. g't'rttß'ig- (41.1), gefräßig. g't'reut (4), Vw., was Freude macht, g'i'rnrä (_to), die, Frofibeulen: i 1111 (1* g. g't'rörllg ...
autorJakob Hunziker
Teile Aargauer W?rterbuch auf Facebook Teile Aargauer W?rterbuch auf Google + Teile Aargauer W?rterbuch auf Twitter
8
Symbolic Computation in der Pensions- und Krankenversicherung
Beweis: (i) und (ii) sind klar (iii) Fall 1: G(p,t) = 0 Es folgt G(g —l—p,t) = G(g,t) # 0 und daraus g —l—p —>f‚t h1 mit MW+PJ) MWJ) h1 = — — = — = h 9+P LMUU f 9 LMUUI+P +P und wir sind fertig. Fall 2: G(p,t) # O und G(g —l—p,t) 7€ 0 Es gilt ...
autorMartin Predota, 2002
Teile Symbolic Computation in der Pensions- und Krankenversicherung auf Facebook Teile Symbolic Computation in der Pensions- und Krankenversicherung auf Google + Teile Symbolic Computation in der Pensions- und Krankenversicherung auf Twitter
9
Forstwirtschaft und Gefäßpflanzen der roten Liste: Arten - ...
Tt.*..g .g..t..u..g... ....„§..ı..... ....".,I...t.z .„.".ıt..,.., tI.....".tz... '11*1'11111"1 "'fl'1'Y1111'1 .' ...,.,z:=... 11M¶ ..t. t... .... .t.. +~~o I... ...I I !+=oLI ›| ırqndo umuınqm ıμctt txaıaaıçø -dn nııııoıd ıoçuoıo/\ =s ävvlıvv *I umıoauo auqdvg uoıt 8ungaq:›s|[asefl1eA.
autorMichael Schön, 1998
Teile Forstwirtschaft und Gefäßpflanzen der roten Liste: Arten - ... auf Facebook Teile Forstwirtschaft und Gefäßpflanzen der roten Liste: Arten - ... auf Google + Teile Forstwirtschaft und Gefäßpflanzen der roten Liste: Arten - ... auf Twitter
10
Grundlagen der industriellen Produktgestaltung
nisse usw."). Der SVK liefert entsprechend dem Nenner von (19) nur diskontinuierliche Werte. Innerhalb einer (2,1)-Matrix als Grenzfall ist nur SVK = 0 oder l möglich. Bereits bei einer für praktische Zwecke kleinen (ll,10)-Matrix — mit m (n ...
Teile Grundlagen der industriellen Produktgestaltung auf Facebook Teile Grundlagen der industriellen Produktgestaltung auf Google + Teile Grundlagen der industriellen Produktgestaltung auf Twitter
APA
REFERENZ
« WÖRTERBUCH DEUTSCH. g. g. T. [online] - Version 3.3 (Okt 2016). <http://worterbuchdeutsch.com/de/g-g-t> »
Wörterbuch Deutsch
SUCHEN Entdecke mehr Wörter im Deutsch Wörterbuch auf Wörterbuch Deutsch
SUCHEN
SUCHEN
zoom
Suche jetzt unter mehr als 300 000 Wörter und Ausdrücken auf Deutsch
a    b    c    d    e    f    g    h    i    j    k    l    m    n    o    p    q    r    s    t    u    v    w    x    y    z